logo
down
shadow

Python: comparing list to a string


Python: comparing list to a string

By : user2956273
Date : November 22 2020, 10:54 AM
Does that help I want to know how to compare a string to a list. For example I have string 'abcdab' and a list ['ab','bcd','da']. Is there any way to compare all possible list combinations to the string, and avoid overlaping elements. so that output will be a list of tuples like [('ab','da'),('bcd'),('bcd','ab'),('ab','ab'),('ab'),('da')]. , This little recursive function should do the job:
code :
def matches(string, words, start=-1):
    result= []
    for word in words: # for each word
        pos= start
        while True:
            pos= string.find(word, pos+1) # find the next occurence of the word
            if pos==-1: # if there are no more occurences, continue with the next word
                break

            if [word] not in result: # add the word to the result
                result.append([word])

            # recursively scan the rest of the string
            for match in matches(string, words, pos+len(word)-1):
                match= [word]+match
                if match not in result:
                    result.append(match)
    return result
>>> print matches('abcdab', ['ab','bcd','da'])
[['ab'], ['ab', 'ab'], ['ab', 'da'], ['bcd'], ['bcd', 'ab'], ['da']]


Share : facebook icon twitter icon
comparing string to class list in python

comparing string to class list in python


By : Prajjwal Agarwal
Date : March 29 2020, 07:55 AM
Hope this helps I am trying to figure out how to compare a string to the 0th element in the list (technically the bottom). The list is also a class instance and looks like this: , I think you just need this
code :
if mylist[0].type == 'Arrival':
Python:Comparing all list items to substring of string

Python:Comparing all list items to substring of string


By : espensje
Date : March 29 2020, 07:55 AM
I wish this help you This finds all substrings of length 5 that are repeated at least 4 or more times (not overlapping) within 50 characters. The resulting list does not have duplicates.
code :
a_str = 'CGGACTCGACAGATGTGAAGAACGACAATGTGAAGACTCGACACGACAGAGTGAAGAGAAGAGGAAACATTGTAA'
b = 5      #length of substring
c = 50     #length of window
repeat = 4 #minimum number of repetitions

substrings = list({
    a_str[i:i+b]
    for i in range(len(a_str) - b)
    if a_str.count(a_str[i:i+b], i+b, i+c) >= repeat - 1
})
print(substrings)
['CGACA', 'GAAGA']
Python string removal by comparing multiple list

Python string removal by comparing multiple list


By : Benjiman Raj
Date : March 29 2020, 07:55 AM
wish of those help Currently, I have 3 list, each with around 20 elements inside: , Lets say we have 3 lists:
code :
a = ['midtown parkst100stockton', 'uptown square200lenton']
b = ['midtown', 'uptown']
c = ['stockton', 'qwerty']
d = []
for i,j,k in zip(a,b,c):
    if i.startswith(j) and i.endswith(k):
        d.append(i.lstrip(j).rstrip(k))
Comparing letters in list with string in a list python

Comparing letters in list with string in a list python


By : Sergey Prikhodchenko
Date : March 29 2020, 07:55 AM
may help you . I have a list lets say: , This line
code :
if letter in arg_list[4][0]:
if char in DIRECTION_LETTERS:
Python programming comparing string to list

Python programming comparing string to list


By : adamsokode
Date : March 29 2020, 07:55 AM
should help you out , First, I think instead of
Related Posts Related Posts :
  • Return new instance of subclass when using methods inherited from parent class in Python
  • Which function in django.contrib.auth creates the default model permissions?
  • Formatting text in tabular form with Python
  • How to determine the first day of a month in Python
  • Error while converting date to timestamp in python
  • Python string iterations
  • Is there any file number limitation when you select multiple files with wxFileDialog?
  • Errors with Matplotlib when making an executable with Py2exe (Python)
  • Django Haystack - Indexing single field
  • Go Pro Hero 3 - Streaming video over wifi
  • Appending a column in .csv with Python/Pandas
  • How to change my result directory in Robot framework using RIDE?
  • problem with using pandas to manipulate a big text file in python
  • python-magic module' object has no attribute 'open'
  • Where goes wrong for this High Pass Filter in Python?
  • Why inserting keys in order into a python dict is faster than doint it unordered
  • flann index saving in python
  • Create new instance of list or dictionary without class
  • How can I easily convert FORTRAN code to Python code (real code, not wrappers)
  • Address of lambda function in python
  • Python adding space between characters in string. Most efficient way
  • python http server, multiple simultaneous requests
  • Disguising username & password on distributed python scripts
  • Post GraphQL mutation with Python Requests
  • Why doesnt pandas create an excel file?
  • Rolling comparison between a value and a past window, with percentile/quantile
  • How to avoid repetitive code when defining a new type in python with signature verification
  • How to configure uWSGI in order to debug with pdb (--honour-stdin configuration issue)
  • In Python, how do you execute objects that are functions from a list?
  • Python- Variable Won't Subtract?
  • Processing Power In Python
  • Python 2.7.2 - Cannot import name _random or random from sys
  • Why doesn't the Python sorted function take keyword order instead of reverse?
  • Make a function redirect to other functions depending on a variable
  • get_absolute_url in django-categories
  • Monitoring non-Celery background task with New Relic in Python
  • Feature selection with LinearSVC
  • LSTM - Predicting the same constant values after a while
  • Test the length of elements in a list
  • Django: render radiobutton with 3 columns, cost column must change according to size & quantity selected
  • Python class attributes vs global variable
  • sys.stdout.writelines("hello") and sys.stdout.write("hello")
  • is ndarray faster than recarray access?
  • Python - search through directory trees, rename certain files
  • GAE: How to build a query where a string begins with a value
  • TypeError: __init__() takes at least 2 arguments (1 given)
  • Overriding and customizing "django.contrib.auth.views.login"
  • Django : Redirect to a particular page after login
  • Python search and copy files in directory
  • pretty printing numpy ndarrays using unicode characters
  • Frequent pattern mining in Python
  • How can I make a set of functions that can be used synchronously as well as asynchronously?
  • Convert one dice roll to two dice roll
  • count occourrence in a list
  • Writing an If condition to filter out the first word
  • to read file and compare column in python
  • Install python-numpy in the Virtualenv environment
  • `.select_by_visible_text()` is failed to select element?
  • Unable to send data multiple requests in a single connection — socket error
  • Pandas HDFStore unload dataframe from memory
  • shadow
    Privacy Policy - Terms - Contact Us © ourworld-yourmove.org